Najnovija znanstvena istraživanja – o beskorisnosti maski

0
2194
LUDILO IDE DALJE

CAPAK & EKIPA VIŠE NE ZNAJU ŠTO RADE A MI ŠUTIMO

inbound4914097932540085986

 

 

1 DIO

 

Danas mi u ruke dospio dokument, ili bolje, uputa u kojoj se točno navodi što je novinarima činiti, bolje rečeno što ne smiju činiti – spominjati tijekom press konferencija i pisanja članaka.

 

Gdje su sad vrli FAKTOGRAFCI? Javite se, oborite ove moje navode, a krećem sa pisanjem u nastavcima, ne za vas FAKTOGRAFCI  jer vi ionako veze nemate jer nemate kompetencije.

 

Ne brini(te)!

image.png
Ja sam također testiran pozitivno, za 2 mandat!

Molim sve čitatelje ovo pročitati, uz dodatan napor, ali ne odustajte.

Ovo je štivo preteško i meni i vama. Ovo nije za prodane liječnike i tzv političku elitu.

Ovo će prije razumjeti jednostavan, običan, normalan, prispost čovjek zdrave logike i zdrave pameti. Nije za one koji imaju cijenu ili su već kupljeni.

 

Ovo će u cijelosti razumjeti samo par hrabrih ljudi u Hrvatskoj koji su o svemu ovome i javno govorili.

Nažalost, u soroš-gates-boljševičke medije ne mogu proći. Stoga narod i živi u strahu slušajući neku „zakletu“ Hipokratovu braću koja „pomaže“ sama sebi a ne onima zbog kojih su se zakleli, pacijentina. Vrijeme je konačno otvoreno govoriti o tome.

Nepodnošljivo je slušati stalno iste stožeraše, ali i njihovu zamjenu u javnom prostoru, neke nove „stožerašiće“, Kolariće, te danas jednog dr Gzim Ređepija (Šostarov kadar iz Grada) u jutarnjoj emisiji soroš-gates-boljševičke HRTV u kojoj izreče za običan puk prestrašnu laž. Kaže tako taj dr Gzim Ređepi: „ korona je prestrašna zaraza!“ Ako se ne varam za širenje lažnih vijesti i dezinformacija postoji i odredba  u Prekršajnom zakonu. Vrijeme ju je prebaciti u Kazneni zakon RH. Vremena su odgovornosti, sve ih treba pozvati na odgovornost.

 

Znači, ovo pišem zbog svih nas običnih ljudi svjesnih svih okolnosti i događaja, te ovog besramnog eksperimenta i samo onih nekoliko u Hrvatskoj vrhunskih intelektualaca i znalaca iz područja o kojemu govore ova dva znanstvena rada, u prvom dijelu ovog serijala.

 

Pišem za:

dr. sc. Srećka Sladoljeva, prof. dr. sc. Krešimira Pavelića, dr. Nadu Jurinčić, prof. dr. sc. Valerija Vrčeka, dr. Lidiju Gajski te doc. dr. sc. Sanju Musić Milanović (inače epidemiologa, što je vrlo bitno u ovim okolnostima).

Riječ je o UPUTAMA koje dobiše ljudi iz medija, a dalje pogledajte sami.         

image.png

1.    Maske ne pomažu pri aerosolnom širenju virusa, a dokazno je širenje cov-sars-2 virusa aerosolom

Objavljen 3. travnja 2020.

 

Izbacivanje  respiratornog virusa u izdahnutom dahu i djelotvornost maski za lice

 

AUTORI:

Sažetak

Identificirali smo sezonske humane koronaviruse, viruse gripe i rinoviruse u izdahnutom dahu i kašlju djece i odraslih s akutnom respiratornom bolešću. Kirurške maske za lice značajno su smanjile otkrivanje RNK virusa gripe u respiratornim kapljicama i RNA koronavirusa u aerosolima, s trendom prema smanjenom otkrivanju RNA koronavirusa u respiratornim kapljicama. Naši rezultati pokazuju da bi kirurške maske za lice mogle spriječiti prijenos ljudskih koronavirusa i virusa gripe od simptomatskih osoba.

 

Glavni dio

Infekcije respiratornih virusa uzrokuju širok i preklapajući spektar simptoma koji se zajednički nazivaju akutnim respiratornim virusnim bolestima (ARI) ili češće „prehladom“. Iako su uglavnom blage, ove ARI ponekad mogu uzrokovati teške bolesti i smrt 1 . Ti se virusi šire među ljudima izravnim ili neizravnim kontaktom, respiratornim kapljicama (uključujući veće kapljice koje brzo padaju u blizini izvora, kao i grube aerosole aerodinamičnog promjera> 5 µm) i aerosole sitnih čestica (kapljice i jezgre kapljica aerodinamičnog promjera ≤5 um) 2 , 3. Iako su higijena ruku i uporaba maski za lice, prvenstveno usmjerene na kontakt i prijenos kapljica dišnog sustava, predloženi kao važne strategije ublažavanja prijenosa virusa gripe 4 , malo se zna o relativnoj važnosti ovih načina u prijenosu ostalih uobičajenih respiratornih virusa 2 , 3 , 5 . Neizvjesnosti se slično primjenjuju i na načine prijenosa COVID-19 (reference 6 , 7 ).

Neke zdravstvene vlasti preporučuju da bolesne osobe nose maske kako bi se spriječio daljnji prijenos (kontrola izvora) 4 , 8 . Kirurške maske za lice izvorno su uvedene kako bi zaštitile pacijente od infekcije rane i onečišćenja od kirurga (nositelja) tijekom kirurških zahvata, a kasnije su usvojene kako bi zaštitile zdravstvene radnike od zaraze njihovih pacijenata. Međutim, većina postojećih dokaza o djelotvornosti filtriranja maski za lice i respiratora dolazi iz in vitro pokusa s nebiološkim česticama 9 , 10, koji se možda neće generalizirati za kapljice zaraznog respiratornog virusa. Malo je podataka o učinkovitosti maski za lice u filtriranju respiratornih virusa i smanjenju oslobađanja virusa od osobe koja ima respiratorne infekcije 8 , a većina istraživanja usredotočila se na gripu 11 , 12 .

Ovdje smo imali za cilj istražiti važnost putova prijenosa respiratornih kapljica i aerosola s posebnim naglaskom na koronaviruse, viruse gripe i rinoviruse, kvantificirajući količinu respiratornog virusa u izdahnutom dahu sudionika koji su medicinski pohađali ARI i utvrdili potencijalnu učinkovitost kirurškog zahvata maske za lice kako bi se spriječio prijenos respiratornog virusa.

Rezultati

Pregledali smo 3.363 osobe u dvije faze ispitivanja, na kraju upisavši 246 osoba koje su dale uzorke izdahnutog daha (Prošireni podaci, slika 1 ). Među ovih 246 sudionika, 122 (50%) sudionika randomizirano je da nisu nosili masku za lice tijekom prve kolekcije izdahnutog daha, a 124 (50%) sudionika randomizirano je da nose masku za lice. Sveukupno, 49 (20%) je dobrovoljno dalo drugu kolekciju izdahnutog daha alternativnog tipa.

 

Infekcije barem jednim respiratornim virusom potvrđene su PCR-om reverzne transkripcije (RT – PCR) u 123 od 246 (50%) sudionika. Od tih 123 sudionika, 111 (90%) je zaraženo humanim (sezonskim) koronavirusom ( n  = 17), virusom gripe ( n  = 43) ili rinovirusom ( n  = 54) (prošireni podaci, slike 1 i 2 ), uključujući jedan sudionik koinficiran i koronavirusom i virusom gripe, a druga dva sudionika koinficirana i rinovirusom i virusom gripe. Ovih 111 sudionika bili su fokus naših analiza.

 

Postojale su neke manje razlike u karakteristikama 111 sudionika s različitim virusima (tablica 1a ). Sveukupno, 24% sudionika imalo je izmjerenu temperaturu ≥37,8 ° C, dok su pacijenti s gripom više nego dvostruko vjerojatniji od izmjerene temperature u odnosu na bolesnike zaražene koronavirusom i rinovirusom. Sudionici zaraženi koronavirusom najviše su se nakašljali s prosječno 17 (sd = 30) kašlja tijekom 30-minutne kolekcije izdahnutog daha. Profili sudionika randomiziranih u skupine s maskom nasuprot grupama bez maske bili su slični (dopunska tablica 1 , pogledati u punoj veličini na linku).

 

        1a. Aerosolna i površinska kontaminacija SARS-CoV-2 uočena u karanteni

               i izolacijskoj njezi

objavljen 22. rujna 2020.

Sažetak

Novi teški akutni respiratorni sindrom koronavirus 2 (SARS-CoV-2) nastao je u Wuhanu u Kini krajem 2019. godine, a Svjetska zdravstvena organizacija proglasila ga je pandemijom 11. ožujka 2020. godine. brzo širenje COVID-19 na globalnoj razini predstavlja možda najznačajniju hitnu zdravstvenu zaštitu u stoljeću. Kako je pandemija napredovala, kontinuirano malo dokaza na putovima prijenosa SARS-CoV-2 rezultiralo je promjenom smjernica za prevenciju i kontrolu infekcije između klasično definiranih mjera opreza u zraku i kapljicama. Tijekom početne izolacije 13 osoba s COVID-19 u Medicinskom centru Sveučilišta Nebraska, prikupili smo uzorke zraka i površine kako bismo ispitali prolijevanje virusa od izoliranih osoba. Otkrili smo virusnu kontaminaciju među svim uzorcima,

 

Uvod

Zaštita zdravstvenog radnika i učinkovite mjere javnog zdravlja za nove zarazne bolesti zahtijevaju smjernice koje se temelje na čvrstom razumijevanju načina prijenosa. Oskudni dokazi koji opisuju dinamiku prijenosa SARS-CoV-2 1 doveli su do prenošenja smjernica za izolaciju od SZO-a, američkog CDC-a i drugih tijela javnog zdravstva. Dokazi sugeriraju da druge nove bolesti koronavirusa (npr. SARS i MERS) imaju potencijal zračnog prijenosa 2 , 3, uz izravniji kontakt i kapljični prijenos. Barem jedna studija sugerira da MERS-CoV ima mogućnost prijenosa od lakše oboljelih ili asimptomatskih osoba 4 . Uzorci površine uzeti u područjima za njegu pacijenata za MERS-CoV i SARS-CoV pokazali su pozitivne rezultate PCR-a3 ; međutim, stručnjaci propituju prisutnost održivog virusa i implikacije na prijenos putem fomita kontaminiranih izravnim kontaktom zaražene osobe ili taloženjem čestica opterećenih virusom na površinu 5 . Unatoč tome, bolničke epidemije sugeriraju prijenos koronavirusa putem onečišćenja okoliša 6 , 7 . Iako se izvještava o nozokomijalnom prijenosu SARS-CoV-2, uloga prijenosa aerosola i onečišćenja okoliša ostaje nejasna, a preventivci infekcije zahtijevaju daljnje podatke kako bi informirali odgovarajuću praksu 8 .

Medicinski centar Sveučilišta u Nebraski (UNMC), sa svojim kliničkim partnerom Nebraska Medicine, zbrinuo je 13 osoba s potvrđenom infekcijom SARS-CoV-2 evakuiranim s broda za krstarenje Diamond Princess 6. ožujka 2020. Pacijentima kojima je bila potrebna bolnička pomoć upravljano je Jedinica za biološki smještaj u Nebraski (NBU), a lakše bolesne osobe izolirane su u Nacionalnoj jedinici za karantenu (NQU), obje smještene u kampusu medicinskog centra. Ključne značajke NBU-a i NQU-a uključuju: (1) pojedinačne sobe s vlastitim kupaonicama; (2) prostorije s negativnim tlakom (> 12 ACH) i hodnici s negativnim tlakom; (3) kontrola pristupa ključnom karticom; (4) protokoli za prevenciju i kontrolu infekcije specifični za jedinicu (IPC), uključujući higijenu ruku i mijenjanje rukavica između soba; i (5) osobna zaštitna oprema (OZO) za osoblje koja je uključivala kontaktnu i aerosolnu zaštitu9 .

 

Rezultati

Pokrenuli smo kontinuirano istraživanje onečišćenja okoliša dobivanjem uzoraka površine i zraka u 2 bolnice NBU i 9 NQU stambenih izolacijskih soba u kojima su smještene osobe koje imaju pozitivan test na SARS-CoV-2. Uzorci su dobiveni u NQU 5-9 dana zauzeća, a u NBU 10. dana. Dodatni uzorci dobiveni su u NBU 18. dana, nakon što je pacijent 3 primljen u jedinicu četiri dana. Dobili smo površinske uzorke, uzorke zraka velikog volumena [50 L / min (Lpm)] i osobne uzorke zraka male količine (4 Lpm). Uzorci površina dolazili su s površina zajedničkih prostorija, osobnih predmeta i toaleta. Osobne uređaje za uzorkovanje zraka nosilo je studijsko osoblje dva dana tijekom uzorkovanja prostorija NBU i NQU.

Tijekom uzorkovanja, osobe izolirane bilježile su simptome i oralne temperature dva puta dnevno. Zabilježena je maksimalna temperatura tijekom tri dana koja su prethodila uzorkovanju, kao i prisutnost bilo kakvih simptoma. Za to je vrijeme 57,9% pacijenata zabilježilo temperaturu veću od 37,2 ° C (99,0 ° F), a 15,8% je imalo temperaturu veću od 37,8 ° C (100 ° F). Neovisno o temperaturi, 57,9% pacijenata prijavilo je druge simptome, prvenstveno kašalj.

Uzorci površine i aerosola analizirani su RT-PCR ciljajući E gen SARS-CoV-2 10 . Od 163 uzorka prikupljenih u ovom istraživanju, 121 (72,4%) je imalo pozitivan PCR rezultat za SARS-CoV-2. Zbog potrebe da se izolirano i na bolničkoj njezi uzrokuje minimalni poremećaj, precizna površina uzorkovana u ovom istraživanju nije bila ujednačena, pa su rezultati predstavljeni kao koncentracija kopija gena prisutnih u oporavljenom tekućem uzorku (kopije / µL). Koncentracije kopija virusnih gena oporavljene od svake vrste uzorka bile su uglavnom niske i vrlo varijabilne od uzorka do uzorka u rasponu od 0 do 1,75 kopija / µL (slika  1 A i tablice S1 i S2), s najvećom koncentracijom dobivenom iz zračne rešetke u NBU. Vrijeme uzorkovanja i brzina protoka bili su poznati za sve uzorke aerosola prikupljenih u ovoj studiji, stoga je izračunata koncentracija u zraku za sve uzorke zraka (kopije / L zraka; tablice S1 i S2 ).

Sveukupno, utvrđeno je da je PCR 70,6% svih uzorkovanih osobnih predmeta pozitivno na SARS-CoV-2 (slika  1 B i tablica S1 ). Od ovih uzoraka, 75,0% raznih osobnih predmeta (opisanih u odjeljku „ Metode “) bilo je pozitivno pomoću PCR-a, sa srednjom koncentracijom od 0,22 kopije / µL. Uzorci mobilnih telefona bili su 77,8% pozitivni na virusnu RNA (0,17 kopija / µL srednja koncentracija), a daljinski upravljači za sobne televizore 55,6% posto (srednja vrijednost 0,22 kopije / µL). Uzorci zahoda u sobi bili su 81,0% pozitivni, sa srednjom koncentracijom od 0,25 kopija / µL. Od svih uzorkovanih površina sobe (slika  1 B i tablica S1), 75,0% bilo je pozitivno na SARS-CoV-2 RNA. 70,8% noćnih ormarića i nosača kreveta ukazalo je na prisutnost virusne RNA (srednja koncentracija 0,26 kopija / uL), kao i 72,7% prozorskih izbočina (srednja koncentracija 0,22 kopije / uL) uzorkovanih u svakoj sobi. Uzorčeni su i pod ispod kreveta pacijenata i ventilacijske rešetke u NBU. Svih pet uzoraka poda, kao i 4 od 5 uzoraka ventilacijskih rešetki pozitivno su testirani RT-PCR-om, sa srednjim koncentracijama od 0,45, odnosno 0,82 kopije / µL.

Uzorci zraka u sobama i u prostorima hodnika (slika  1 B i tablice S1 i S2 ) pružaju informacije o prolijevanju virusa u zraku u tim objektima. Otkrili smo da je 63,2% uzoraka zraka u sobi pozitivno pomoću RT-PCR (srednja koncentracija 2,42 kopije / L zraka). U NBU, za prva dva događaja uzorkovanja izvedena 10. dana, uzorkivač je postavljen na izbočinu prozora dalje od pacijenta (NBU Soba A u kojoj je boravio pacijent 1) i bio je pozitivan na virusnu RNA (tablica S1; 2,42 kopije / L zraka). Tijekom događaja uzorkovanja 18. dana u NBU sobi B u kojoj je boravio pacijent 3, jedan je uzorkivač stavljen blizu pacijenta, a jedan blizu vrata udaljenih više od 2 m od kreveta pacijenta dok je pacijent primao kisik (1 L) putem nosa kanila. Oba uzorka bila su pozitivna PCR-om, a onaj najbliži pacijentu ukazivao je na veću koncentraciju RNA u zraku (4,07 u odnosu na 2,48 kopija / L zraka). Uzorci uzeti izvan prostorija u hodnicima bili su pozitivni 58,3% (slika  1 B i tablica S2 ), sa srednjom koncentracijom od 2,51 kopije / L zraka. Oba osobna uzorkivača zraka od osoblja za uzorkovanje u NQU pokazala su pozitivne rezultate PCR-a nakon 122 minute aktivnosti uzorkovanja (tablica S2), a oba uzorkivača zraka iz uzorka NBU ukazala su na prisutnost virusne RNA nakon samo 20 minuta aktivnosti uzorkovanja (tablica S2 ). Najveće koncentracije u zraku zabilježili su osobni uzorkivači u NBU-u dok je pacijent primao kisik kroz nosnu kanilu (19,17 i 48,22 kopije / L). Ni kod pojedinaca u NQU-u ni kod pacijenata u NBU-u nije primijećeno da kašlju dok je osoblje za uzorkovanje bilo u sobi noseći uzorke za vrijeme tih događaja.

Iz svake je sobe prikupljeno između 5 i 16 uzoraka, sa prosjekom od 7,35 uzoraka po sobi i načinom od 6 uzoraka po sobi. Postotak pozitivnih uzoraka iz svake sobe kretao se između 40 i 100% (slika  1 B, 2A). Korelacija Spearman’s Rank Order (ρ) posto pozitivnih uzoraka i ukupnog broja uzoraka za svaku sobu imala je vrijednost 0,33, što ukazuje na slabu povezanost između broja uzetih uzoraka i postotka promatranih pozitivnih uzoraka, što je vjerojatno posljedica fokus neplaniranih uzoraka na područja ili predmete koje pacijenti često koriste. Kada se uspoređuje postotak uzetih pozitivnih uzoraka s maksimalnom zabilježenom oralnom temperaturom pacijenta tijekom prethodna tri dana, ρ od 0,39 ukazuje samo na slabu povezanost između povišene tjelesne temperature i ispuštanja virusa u okolišu. Nadalje, zabilježena oralna temperatura uspoređena je s koncentracijom kopije gena za svaki tip uzorka u sobi (tablica S1). Te su se vrijednosti ρ kretale od -0,02 (mobiteli) do 0,36 (uzorci zraka), što ukazuje na slabu ili nikakvu značajnu povezanost između tjelesne temperature i onečišćenja okoliša, pri čemu su uzorci zraka imali najjaču korelaciju, praćeni prozorskim daskama (ρ = 0,25) i daljinskim upravljačima ( ρ = 0,23).

 

Podgrupa uzoraka koji su bili pozitivni na virusnu RNA pomoću RT-PCR ispitivana je za širenje virusa u Vero E6 stanicama. Za određivanje replikacije virusa korišteno je nekoliko pokazatelja, uključujući citopatski učinak (CPE), imunofluorescentno bojanje, PCR vremenskog tijeka supernatanta stanične kulture i elektronsku mikroskopiju. Zbog niskih koncentracija prikupljenih u tim uzorcima, uzgoj virusa nije potvrđen u tim eksperimentima. Ipak, u dva uzorka stanična kultura ukazala je na neke dokaze o prisutnosti virusa za replikaciju (slika  2 ): uzorak zraka iz hodnika NQU 8. dana i prozorske klupice NQU A 5. dana (tablice S1 i S2 ). Mikroskopski pregled staničnih kultura pokazao je CPE nakon 3-4 dana (slika  2A, B). Serijski PCR supernatanta stanične kulture bio je nejasan, ali uočene promjene u supernatantu RNA u uzorku hodnika, pokazale su da nakon početnog smanjenja RNA u supernatantu (u skladu s dnevnim povlačenjem supernatanta za analizu i zamjenu svježim supernatantom) možda se dogodio određeni porast virusne RNA (slika  2 C). Uzorak prozorske daske imao je dosljednu virusnu RNA u supernatantu tijekom cijelog vremenskog tijeka, unatoč svakodnevnom povlačenju supernatanta za analizu, što bi moglo ukazivati na replikaciju (slika  2 D). Dalje, imunofluorescentne slike (slika  2 E) ukazuju na dokaze o virusnim proteinima u uzorku hodnika i transmisijskoj elektronskoj mikroskopiji (TEM) uzorka prozorske daske (slika  2F) potvrdio prisutnost netaknutih SARS-CoV-2 viiona nakon 3 dana stanične kulture.

Rasprava

Ovi podaci zajedno ukazuju na značajnu kontaminaciju okoliša u sobama u kojima su smješteni i zbrinuti pacijenti zaraženi SARS-CoV-2, bez obzira na stupanj simptoma ili oštrinu bolesti. Kontaminacija postoji u svim vrstama uzoraka: uzoraka zraka velike i male količine, kao i uzoraka površina, uključujući osobne predmete, površine soba i toalete. Uzorci toaleta za pacijente koji su pozitivno testirani na virusnu RNK u skladu su s ostalim izvještajima o prolijevanju virusa u stolici 11. The presence of contamination on personal items is also expected, particularly those items that are routinely handled by individuals in isolation, such as cell phones and remote controls, as well as medical equipment that is in near constant contact with the patient. The observation of viral replication in cell culture for some of the samples confirms the potential infectious nature of the recovered virus.

Primijetili smo varijabilnost u stupnju onečišćenja okoliša (mjereno postotkom pozitivnih uzoraka) iz sobe u sobu i iz dana u dan. Općenito, postotak pozitivnih uzoraka u NQU-u bio je veći 5-7. Dana (72,5%) u odnosu na 8-9. Dan (64,9%). Iako je većina NQU soba imala veći postotak pozitivnih uzoraka ranije tijekom bolesti, tri od devet soba (NQU B, G i I) zapravo su imale veći postotak kasnijih dana (8. i 9. dan). U prosjeku je veći postotak pozitivnih uzoraka (81,4% u 3 sobe) otkriven u NBU kasnije tijekom bolesti (uzorkovano 10. i 18. dana), što sugerira da pacijenti s većom oštrinom bolesti ili razinom njege mogu biti povezane s povećanim razinama onečišćenja okoliša. Međutim,

U bolnici NBU, gdje su pacijenti uglavnom bili manje pokretni, raspodjela pozitivnih uzoraka sugerira snažan utjecaj protoka zraka. Osobni predmeti i predmeti osjetljivi na dodir nisu bili univerzalno pozitivni, no otkrili smo virusnu RNA u 100% uzoraka s poda ispod kreveta i svih, osim jedne prozorske izbočine (koje pacijent nije koristio) u NBU. Protok zraka u NBU apartmanima potječe iz registra u gornjem središtu sobe i izlazi iz rešetki u blizini glave pacijentovog kreveta s obje strane sobe. Modeliranje protoka zraka 12je sugerirao da je neki dio protoka zraka usmjeren ispod pacijentovog kreveta, što može prouzročiti opaženu kontaminaciju ispod kreveta, dok dominantni protok zraka vjerojatno odvodi čestice od pacijentovog kreveta prema rubovima sobe, vjerojatno prolazeći pored prozora što rezultira u nekom taloženju tamo.

Iako ovo istraživanje nije koristilo nikakve tehnike frakcioniranja veličine kako bi se odredio raspon veličina kapljica i čestica SARS-CoV-2, podaci sugeriraju da virusne čestice aerosola proizvode osobe koje imaju bolest COVID-19, čak i u odsutnost kašlja. Prvo, u nekoliko slučajeva kada se udaljenost između pojedinaca u izolaciji i uzorkovanju zraka mogla pouzdano održavati na većoj od 6 stopa, 2 od 3 uzorka zraka bila su pozitivna na virusnu RNA. Drugo, 58,3% uzoraka zraka u hodniku ukazuje da su se čestice koje sadrže virus prevozile iz prostorija u hodnik tijekom aktivnosti uzorkovanja. Vjerojatno su pozitivne uzorke zraka u hodniku uzrokovale virusne aerosolne čestice koje je osoblje koje je izlazilo iz prostorije 13 , 14 transportiralo ili resuspendiralo. Napokon, svi osobni uzorkivači zraka koje je nosilo osoblje za uzorkovanje bili su pozitivni na SARS-CoV-2, unatoč tome što većina pacijenata nije kašljala dok je osoblje za uzorkovanje bilo prisutno. Nedavna literatura koja istražuje aerosol kojem je istjekao čovjek sugerira da je velika frakcija promjera manja od 10 µm za sve vrste aktivnosti (npr. Disanje, razgovor i kašalj 15 ) te da bolest gornjih dišnih putova povećava proizvodnju aerosolnih čestica (manje od 10 µm) 16 . Nedavno istraživanje stabilnosti SARS-CoV-2 ukazuje na to da se zarazni aerosol može zadržati nekoliko sati i na površinama čak 2 dana 17 .

Naše istraživanje sugerira da je kontaminacija okoliša SARS-CoV-2 oko pacijenata s COVID-19 opsežna, a bolnički IPC postupci trebali bi uzeti u obzir rizik od prijenosa virusa fomitom i potencijalno u zraku. Unatoč široko rasprostranjenoj kontaminaciji okoliša i ograničenoj aerosolnoj kontaminaciji SARS-CoV-2 povezanom s hospitaliziranim i lakše oboljelim osobama, provedbom standardnog niza postupaka za prevenciju i kontrolu infekcije spriječeni su dokumentirani slučajevi COVID-19 kod zdravstvenih radnika koji su praćen 14 dana nakon zadnjeg kontakta s bilo kojim odjelom i podvrgnut je dva PCR testa nazalnog brisa u razmaku od 24 sata ako su prijavili vrućicu ili bilo kakve simptome respiratorne infekcije. Standardni IPC protokoli i za NBU i za NQU uključuju sobe s negativnim tlakom s 12-15 izmjenjivanja zraka na sat, hodnici s negativnim tlakom u apartmanu u usporedbi s vanjskim dijelom, stroga kontrola pristupa, visoko obučeno osoblje s dobro razvijenim protokolima, često čišćenje okoliša i zaštitna oprema za zaštitu od aerosola koja se sastojala od N95 filtrirajućih maski za disanje u NQU i respiratora za pročišćavanje zraka za pogon skrb o pacijentima unutar NBU-a. Potrebna je daljnja studija kako bi se rizik u potpunosti kvantificirao.

Metode

Uzorčeni su osobni predmeti osjetljivi na dodir koji uključuju mobitele, opremu za vježbanje, daljinske upravljače za televiziju i medicinsku opremu. Testirane površine soba uključivale su ventilacijske rešetke, ploče stola i prozorske izbočine. Uzorci zahoda dobiveni su s ruba posude. Uzorci zraka prikupljani su u izolacijskim sobama i na hodnicima NBU-a i NQU-a tijekom aktivnosti uzorkovanja, dok su pacijenti bili prisutni. Osobne uzorkivače zraka nosilo je osoblje za uzorkovanje u dva navrata tijekom aktivnosti uzorkovanja: jednom tijekom uzorkovanja u NQU-u kada je uzorkovano 6 pojedinačnih soba i jednom u bolničkom NBU-u kada je uzorkovana jedna soba.

Površinski i osobni predmeti prikupljeni su pomoću 3 × 3 sterilnih jastučića od gaze prethodno navlaženih s 3 ml fiziološke otopine puferirane fosfatom (PBS). Uzorci površine velike površine prikupljeni su brisanjem u uzorku „S“ u 2 smjera kako bi se pokrila što veća količina dostupne površine. Manji predmeti (npr. Mobiteli, daljinski upravljači) obrisani su u jednom smjeru na svakoj dostupnoj površini. Nakon uzimanja uzorci su pakirani u konusne epruvete od 50 ml. Između uzimanja svakog uzorka izvršene su higijene ruku i promjene rukavica.

 

Osobne stvari

Nekoliko osobnih predmeta uzorkovano je dosljedno između svih karantenskih prostorija (mobiteli i daljinski upravljači za televiziju). Uz to, pojedinci su pitani o tome koje su predmete često koristili ili s kojima su često rukovali, a na temelju tih odgovora prikupljeno je nekoliko dodatnih uzoraka: oprema za vježbanje, medicinska oprema (spirometar, pulsni oksimetar, nosna kanila), osobna računala, iPad-i, naočale za čitanje i lonci koji se koriste za zagrijavanje vode. Ova posljednja kategorija grupirana je kao „Razni osobni uzorci“.

Površine soba

U svakoj sobi je uzorkovano nekoliko površina. Za sobe u Nacionalnoj jedinici za karantenu uzorkovani su i prozorska daska i noćni ormarić. Za sobe u Biocontainment Unit-u Nebraska uzorci su uzeti na prozorskoj dasci, nosaču kreveta ili noćnom ormariću, ispod pacijentovog kreveta i na povratnoj rešetki klima uređaja najbliže vratima.

Uzorci zraka

Nepokretni uzorci zraka, kako unutar tako i izvan soba za bolesnike, prikupljeni su pomoću uzorka zraka za zračnu luku Sartorius MD8 koji radi pri 50 Lpm u trajanju od 15 minuta. Uzorci su sakupljeni na 80 mm želatinski filtar. Uzorci u bolesničkim sobama stavljani su na noćne ormariće i noćne ormariće, ali najmanje 1 m od pacijenta. Nije pokušan osigurati da je uzorkivač postavljen na određenu udaljenost od pojedinca u sobi, pa, iako udaljenost između uzorkovatelja i pojedinca nije bila niti definirana niti dosljedna, pojedinci u sobi nisu izravno komunicirali s uzorkivačem.

Ispitanici s NQU-om bili su ambulantni i svi su ustali iz kreveta tijekom uzorkovanja. Naš protokol NQU savjetuje pacijentima izolirano da drže udaljenost od 6 stopa od osoblja koje ulazi u njihovu sobu i nose proceduralnu masku (npr. Kiruršku masku) dok je osoblje u sobi. Primijećeno pridržavanje ovih postupaka bilo je visoko tijekom boravka pacijenta. Za ovo istraživanje pojedinci su upućeni da mogu ukloniti masku tijekom aktivnosti uzorkovanja zraka; međutim, mnogi ga pojedinci nisu uklonili i stoga se u ovoj studiji ne može procijeniti utjecaj zaraženih osoba koje nose maske.

Osoblje ispitivanja uglavnom je napuštalo prostorije tijekom značajnog vremenskog razdoblja tijekom uzorkovanja zraka, ali čini se da nisu svi pacijenti uklanjali proceduralne maske tijekom tih razdoblja. Uzorci zraka za hodnik dobiveni su postavljanjem uzorkivača na pod oko 10 cm od okvira vrata u blizini prostorija u kojima su se odvijale aktivnosti uzorkovanja. Osoblje studija ulazilo je i izlazilo iz soba nekoliko puta tijekom uzorkovanja zraka. Dodatno osobno uzorkovanje zraka prikupilo je studijsko osoblje tijekom aktivnosti uzorkovanja noseći Personal Button Samplers (SKC, Inc.) i koristeći Air Chek pumpe (SKC, Inc.) oba uzorkovanja pri 4 Lpm. Ti su uzorci prikupljeni na želatinskim filtrima od 25 mm.

 

Oporavak uzorka, ekstrakcija RNA i PCR reverzne transkriptaze

Površinski uzorci dobiveni su dodavanjem 15 ml sterilnog PBS u konusnu bočicu koja sadrži jastučić od gaze i ručno mućkanje konusa tijekom 1 minute. 25 mm želatinski filtri uklonjeni su iz kućišta filtra i stavljeni u konusnu epruvetu od 50 ml, a zatim otopljeni dodavanjem 10 ml sterilnog PBS. 80 mm želatinski filtri uklonjeni su iz kućišta filtra, pažljivo presavijeni i stavljeni u konusnu epruvetu od 50 ml, a zatim otopljeni dodavanjem 15 ml sterilnog PBS-a. Ekstrakcije RNA izvedene su pomoću Qiagen DSP kompleta za zavrtanje virusa (QIAGEN GMbH, Hilden, Njemačka) 200 do 400 ul početnog uzorka korišteno je za ekstrakciju RNA, a negativna kontrola ekstrakcije uključena je u svaki set ekstrakcija. Uzorci su eluirani u 50 ul Qiagen pufera AVE. RT-PCR izveden je pomoću kvantitativnog RT-PCR sustava Invitrogen Superscript III Platinum u jednom koraku. Svaka PCR serija uključivala je pozitivnu kontrolu sintetičke DNA i negativnu kontrolu bez nukleaze vode. Uz to su analizirani i slijepi uzorci swipes-a i želatinskih filtara, koji su se nosili tijekom uzorkovanja, i oni koji se čuvaju u laboratoriju. Nije primijećeno pojačavanje slijepih uzoraka. Reakcije su postavljene i pokrenute s početnim uvjetima od 10 minuta na 55 ° C i 4 minute na 94 ° C, a zatim 45 ciklusa od 94 ° C tijekom 15 s i 58 ° C tijekom 30 s, koristeći QuantStudio 3 (Applied Biosytems, Inc) sljedeći reagensi:

6.1 µL vode bez nukleaze

12,5 µL Invitrogen 2X Master Mix

0,4 uL MgS04

0,5 µL smjese temeljnog premaza / sonde (IDT) *  (temeljni premazi 10uM, sonda 5uM)

0,5 µl SuperScript III Platinum Taq

5,0 µL ekstrahirane RNA uzorka, vode bez nukleaze ili pozitivne kontrole

25,0 µL Ukupno

Kako bi se iz izmjerenih vrijednosti Ct kvantificirao broj kopija virusnih gena prisutnih u svakom uzorku, razvijena je standardna krivulja korištenjem sintetičke DNA. Sa 6-log Standardna krivulja je u duplikatu na početku koncentraciji od 1 x 10 3  kopija / mL. Podaci su odgovarali eksponencijalnoj funkciji:

kopijakoncentracija lijevo( frackopije upmu textL desno)=3 puta106e−0,421 putaCtkopijakoncentracija lijevo( frackopije upmu textL desno)=3 puta106e−0,421 putaCt

gdje je Ct vrijeme ciklusa u kojem je pojačanje definitivno. Jednadžba je tada korištena za pretvaranje svih izmjerenih vrijednosti Ct iz svih uzoraka u koncentracije genskih kopija. Minimalna koncentracija otkrivena ovim pokusom bila je 1e -1  kopija / µL između 39 i 44 ciklusa. Uzimajući u obzir volumen uzorka od 5 µL, gornja izvedena eksponencijalna funkcija i nesigurnost u učinkovitosti pojačavanja ekstrakcije RNA preko 39,2 tretiraju se kao neotkriveni, što je jednako 1 kopiji u 5 µL oporavljenog uzorka. Prosječne i standardne koncentracije odstupanja izračunate su iz trostrukih PCR pokusa za svaki uzorak.

Primeri i sonda korišteni u ovoj studiji (u nastavku) temelje se na prethodno objavljenom pokusu 10 koji cilja E gen SARS-CoV-2, koji proizvodi protein male ovojnice ovojnice. Gen je korišten kao meta na temelju sličnosti s prethodno identificiranim koronavirusom, uključujući soj SARS-CoV Frankfurt i dva CoV povezana s SARS-om šišmiša (GenBank Acc. No. MG772933.1 i NC_014470). Primer-BLAST 18Alat je korišten za ispitivanje specifičnosti testa izvan onoga što je opisano u izvornoj publikaciji. Pretraživanje je koristilo zadane parametre i dopustilo 9 neusklađenosti prije ignoriranja ciljane sekvence. Pretraga je vratila pogotke iz 957 izoliranih sekvenci SARS-CoV-2 i 7 izoliranih sekvenci pangolin koronavirusa, što ukazuje na to da bi trebao biti osjetljiv na SARS-CoV-2 i imati potencijalnu unakrsnu reakciju na povezane nehumane koronaviruse. Pozitivna kontrola sastojala se od ssDNA, ciljane na gen E i N (dolje), u smjesi 1: 1 u 10 3  kopije / uL. ssDNA se temeljila na sekvenci genoma 2019-nCoV objavljenoj u Genbank 19 .

Primeri i sonda ciljanog gena E:

Sonda: 5 ′ / 56-FAM / ACACTAAGCC / ZEN / ATCCTTACTGCGCTTCG / 3AIBkFG / -3 ‘

Primer 1: 5′-ATATTGCAGCAGTACGCACACA-3 ‘

Primer 2: 5′-ACAGGTACGTTAATAGTTAATAGCGT-3 ‘

 

ssDNA E ciljni slijed:

5′TTCGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTG

GTATTCTTGCTAGTTACACTAGCCATCCTTACTGCGCTTCGATTGTGTGCGTACTGCTGC

AATATTGTTAACGTG-3 ‘

 

ssDNA N ciljni slijed:

5′ACCAAAAGATCACATTGGCACCCGCAATCCTGCTAACAATGCTGCAATCGTGCTACA

ACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAAGGGAGCAGAGGCGG

CAGTCAAGCCTCTTCTCGTTCCTCATCACGTAGT-3 ‘

 

Ispitivanja stanične kulture

Stanice Vero E6 korištene su za uzgoj virusa iz uzoraka okoliša. Stanice su uzgajane u Dulbeccosovom minimalnom bitnom mediju (DMEM), nadopunjenom zagrijanim fetalnim goveđim serumom (10%), penicilinom / streptomicinom (10 000 IU / ml i 10 000 µg / ml) i amfotericinom B (25 µg / ml). Za razmnožavanje dodano je 100 ul nerazrijeđenih uzoraka na ploče s 24 jažice. Stanice su svakodnevno praćene kako bi se otkrilo CPE izazvano virusom. Nakon 3-4 dana skupljeni su stanični supernatanti i lizati. Za vremenske tijekove PCR eksperimenata, supernatant se prikuplja svaki dan. Uzorci su procijenjeni na citopatski učinak. Imunofluorescencija, izvedena uporabom mišjeg monoklonskog SARS-CoV za određivanje prisutnosti virusnih antigena. Reagens je dobiven putem BEI Resources, NIAID, NIH: Monoclonal Anti-SARS-CoV S Protein (Slično 540C), NR-618. Stanične jezgre obilježene su Hoechstom 33342. Konfokalne slike prikupljene su Ziessom LSM 800 s Airyscanom. Za elektronsku mikroskopiju uzorci su fiksirani, obrađeni, zatim secirani i potom podvrgnuti prijenosnoj elektronskoj mikroskopiji (TEM). CPE slike stečene su u laboratoriju za javno zdravstvo Nebraske (NPHL) BSL3, koristeći 3D tiskani očni adapter za fotografiranje mobitelom, ljubazno doniran od strane dr. Jesse Cox, Yellow Basement Designs.

 

Odobrenje etike

Ovo je istraživanje provedeno u Nacionalnoj jedinici za karantenu i Jedinici za biokontrolu Nebraske s dopuštenjem Medicinskog centra Sveučilišta Nebraska i Nebraske Medicine kao dio studije osiguranja kvalitete / poboljšanja kvalitete na izolacijskoj skrbi. Uzorkovanje pojedinih osobnih predmeta obavljeno je uz dopuštenje vlasnika. Pacijenti su obaviješteni da uporaba zaštitnog pokrivača za lice nije potrebna tijekom aktivnosti uzorkovanja, ali odluka o nošenju ili ne nošenju pod uvjetom da se kirurške maske prepusti pojedincu. Ovu aktivnost pregledao je Ured za regulatorna pitanja Medicinskog centra Sveučilišta Nebraska i utvrdilo je da ovaj projekt ne predstavlja istraživanje na ljudskim predmetima kako je definirano u 45CFR46.102.

image.png

Kao što na početku rekoh, ovo je običnim ljudima jasno i bez znanstvenog truda uloženog u ova dva istraživanja koja sve govore.

Maske padaju, ali stožeraši nam ih žele nabiti na lice i dok spavamo.

Ta bi genijalna ideja mogla biti slijedeća.

Zar ćemo i to dozvoliti?

Čujem po našim bolnicama trudnice na porodima nose maske!

Zar je moguće da nam liječnici postaju zločinci?

Bože spasi nas bolesnog profiterstva!

 

Evo kako neki komentiraju po FB. Pametnom dosta.

 

Marjan Buzbaher Novi

Moja mama je bila pozitivna tjedan dana. Naime o čemu se radi. Pripremali su ju za operaciju srca. Prije ulaska u bolnicu na daljnje pretrage te operaciju morala se testirati na kovid a na koji je bila negativna, isla je vadit krv. Nakon tjedan dana opet testiranje na kovid i opet negativna i odlazi u bolnicu ležati na kardiologiju. Nakon tjedan dana obavljenih pretraga na kardiologiji,znaci na odjelu dan prije operacije.Doktor po treci put uzima bris testa na kovid koji bude pozitivan. Mamu su prebacili na zarazno odmah po primitku potvrde testa. U izolaciji je bila ukupno sedam dana. Peti dan su ju po četvrti puta testirali i bila je negativna. Sedmi dan su ju po peti put testirali i bila je negativna. Vratili su ju natrag na pripreme za operaciju i umrla je dan nakon operacije, u subotu.

Obrazloženje:  imala je infarkt za vrijeme operacije te drugi dan nakon operacije.

 

Suncica Perkusic

Sa njemačkog FB: ,Thomas Bretho, jednoj apotekarki koja je morala naručiti PCR testove za korunu, morala je direktno nazvati u Kinu. Nevjerovatno što su je pitali!  Koliko trebaš pozitivnih testova a koliko negativnih? Piše Monika Wagner.

 

Marija Galić-Bajan

Pita sestra:”Jeste bolesni u zadnja dva tjedna?”

Ja:”Jesam. Kad sam zdrava ne idem doktoru.”

Ona:”Imate li ijedan simptom korone?”

Ja:”Imam, onaj da nemam simptoma.”

Ona se smije i kaže:”Ajde uđi i ne za.ebaji.”

 

Pripremila: mr. sc. Arna Šebalj

 

IZVORI:

Respiratory virus shedding in exhaled breath and efficacy of face masks

https://www.nature.com/articles/s41591-020-0843-2

Aerosol and surface contamination of SARS-CoV-2 observed in quarantine and isolation care https://www.nature.com/articles/s41598-020-69286-3

 

VEZANI ČLANAK

SVJETSKI EKSPERT IZ PSIHOLOGIJE, PSIHOPATOLOGIJE I ANTROPOLOŠKE PSIHIJATRIJE prof. dr. sc. Mila Alečković: Maske kod djece će proizvesti nesigurnost, konfuziju, rastrojenost i nedostatak pažnje, kognitivno-intelektualne poremećaje, neurotične pojačane smetnje i strahove , sve do kompletnog autizma!